View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18632_low_21 (Length: 251)
Name: NF18632_low_21
Description: NF18632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18632_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 248
Target Start/End: Complemental strand, 53791835 - 53791595
Alignment:
| Q |
11 |
cagagacatggttgatgattggtttggtttcacagttcagcttactactgaaaaactaa-gcacccgtgagacaaacatgtgcaacgtgtacaacattgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53791835 |
cagagacatggttgatgattggtttggtttcacagttcagcttact---gaaaaactaaagcacccgtgagacaaacatgtgcaacgtgtacaacattgg |
53791739 |
T |
 |
| Q |
110 |
agttaaataaataaagtcaaataactcatttgttcgtttcgtatgcatacaaaactaacattatatctactctatactatatacaaaactaagtagcttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53791738 |
agttaaataaataaagtcaaataactcatttgttcgttttgtatgcatacaaaactaacattatatctactctatactatatacaaaactaagtagcttt |
53791639 |
T |
 |
| Q |
210 |
tcttccttg-----tatttagcctgcctttgcgttattgaacta |
248 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
53791638 |
tcttccttgtattgtatttagcctggctttgcgttattgaacta |
53791595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University