View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18633_low_20 (Length: 312)
Name: NF18633_low_20
Description: NF18633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18633_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 46309198 - 46309136
Alignment:
| Q |
1 |
gctgaagaaaggcttatttgtacacctttgaagaaagactttttacaaaaataggatttcata |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46309198 |
gctgaagaaaggcttatttgtacacctttgaagaaaggctttttacaaaaataggatttcata |
46309136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University