View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18633_low_30 (Length: 237)

Name: NF18633_low_30
Description: NF18633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18633_low_30
NF18633_low_30
[»] chr5 (2 HSPs)
chr5 (1-132)||(11398057-11398188)
chr5 (153-223)||(11397990-11398060)


Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 11398188 - 11398057
Alignment:
1 ttgcttatgattaaagccagcatcataataaattttaaatatattaataatgctcnnnnnnnatttatttatatccaaatatagatgcacttgtggctat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||       ||||||||||||| ||||||||||||||||||||||||    
11398188 ttgcttatgattaaagccagcatcataataaattttaaatatattaataatactctttttttatttatttatatctaaatatagatgcacttgtggctat 11398089  T
101 taaagacatgctcatgagaagggcataaattg 132  Q
    ||||||||||||||||||||||||| ||||||    
11398088 taaagacatgctcatgagaagggcagaaattg 11398057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 153 - 223
Target Start/End: Complemental strand, 11398060 - 11397990
Alignment:
153 attggcgaaagcattcaagaggctgattgaagaggaagataaagaaaatcagttactatcgtatgaaatct 223  Q
    ||||||||||||||| ||  |||||||||||||||||||||||||||||||||| ||||||||||||||||    
11398060 attggcgaaagcatttaaagggctgattgaagaggaagataaagaaaatcagttgctatcgtatgaaatct 11397990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University