View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18633_low_30 (Length: 237)
Name: NF18633_low_30
Description: NF18633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18633_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 11398188 - 11398057
Alignment:
| Q |
1 |
ttgcttatgattaaagccagcatcataataaattttaaatatattaataatgctcnnnnnnnatttatttatatccaaatatagatgcacttgtggctat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11398188 |
ttgcttatgattaaagccagcatcataataaattttaaatatattaataatactctttttttatttatttatatctaaatatagatgcacttgtggctat |
11398089 |
T |
|
| Q |
101 |
taaagacatgctcatgagaagggcataaattg |
132 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |
|
|
| T |
11398088 |
taaagacatgctcatgagaagggcagaaattg |
11398057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 153 - 223
Target Start/End: Complemental strand, 11398060 - 11397990
Alignment:
| Q |
153 |
attggcgaaagcattcaagaggctgattgaagaggaagataaagaaaatcagttactatcgtatgaaatct |
223 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11398060 |
attggcgaaagcatttaaagggctgattgaagaggaagataaagaaaatcagttgctatcgtatgaaatct |
11397990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University