View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18633_low_33 (Length: 227)
Name: NF18633_low_33
Description: NF18633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18633_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 22306426 - 22306229
Alignment:
| Q |
19 |
gaaattatgttctaaattgattccaaaatgaagaaaaaagatttgatatgcaaaccaacgcagtgaattatgttatacttttcttgtgtccacaagtttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22306426 |
gaaattatgttctaaattgattccaaaatgaagaaaaaagatttgatatgcaaaccaacgtagtgaattttgttatacttttcttgtgtccacaagtttc |
22306327 |
T |
|
| Q |
119 |
atatcctactttactgctatattgct-----atttgcataatcggtttgtggcccttaagttttatctgaagatatatgttgattccatatgagtatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22306326 |
atatcctactttactgctatattgctatttaatttgcataatcggtttgtggcccttaagttttatctgaagatatatgttgattccatatgaatatt |
22306229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University