View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18633_low_38 (Length: 214)
Name: NF18633_low_38
Description: NF18633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18633_low_38 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 4644315 - 4644523
Alignment:
| Q |
1 |
acattcgggagagattcgcatcctagtggtggcagctcgacggaaaaatggtcaagctg--acataaggcaaatcgcggcgtgaatactatggagtatgg |
98 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
4644315 |
acattcaggagagattcgcatcctagtggtggcggctcgacggcaaaatggtcaagctgtgacataaggcaaatcgcggcgtgaatactgtgga------ |
4644408 |
T |
 |
| Q |
99 |
atagtatcattctcgttggagaagcagcaacacacaatcaatgagttaaatgatgtagagacatatgccacatctcttcaattaaaactcacgagtttgc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4644409 |
-tagtatcattctcgttggagaagcagcaacacacaatcaatgagttaaatgatgtagagacatatcccacatctcttcaattaaaactcacgagtttgc |
4644507 |
T |
 |
| Q |
199 |
aggttatgtatacaaa |
214 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
4644508 |
aggttatgtaaacaaa |
4644523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University