View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18634_high_6 (Length: 407)
Name: NF18634_high_6
Description: NF18634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18634_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 295; Significance: 1e-165; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 92 - 390
Target Start/End: Original strand, 16276593 - 16276891
Alignment:
| Q |
92 |
aaataatccaaaggctttacataatgaagttggaagcttaagactcatcttacagaggtttcagggcactattactaatatgaatgaagaggtaaatgga |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16276593 |
aaataatccaaaggctttacataatgaagttggaagcttaagactcatcttacagaggtttcagggcactattactaatatgaatgaagaggtaaatgga |
16276692 |
T |
 |
| Q |
192 |
tttttcttaatctttttctaggtagaagggtttgattttcactaataagaatgagcaatatctttagcatttatatgaattaagaattgcattatttcag |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16276693 |
tttttcttaatctttttctaggtagaagggtttgattttcactaataagaatgagcaatatctttagcatttatatgaattgagaattgcattatttcag |
16276792 |
T |
 |
| Q |
292 |
taagagagagatgttttcaaataaaataagataaagctgatatctatggtaaatgctaaagatattctaatattcttctagaaaatctttgacaccatt |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16276793 |
taagagagagatgttttcaaataaaataagataaagctgatatctatggtaaatgctaaagatattctaatattcttctagaaaatctttgacaccatt |
16276891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 16276502 - 16276533
Alignment:
| Q |
1 |
tttaatttcagacaaagaggtatcatattcaa |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16276502 |
tttaatttcagacaaagaggtatcatattcaa |
16276533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University