View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18634_low_16 (Length: 239)
Name: NF18634_low_16
Description: NF18634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18634_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 9072954 - 9072737
Alignment:
| Q |
1 |
ttttccactaattaattatcactaattgtcattgtttccattacacaattccccaaactccatcctcattatttctgaatatttctcattgtgactattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072954 |
ttttccactaattaattatcactaattgtcattgtttccattactcaattccccaaactccatcctcattatttctgaatatttctcattgtgactattc |
9072855 |
T |
 |
| Q |
101 |
ttcttctttttgtagaagtattgatgaatnnnnnnnnnntgcaatgcatggtttttgttttgctttcattcactttattcaatgtctcttttatgtgagt |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9072854 |
ttcttctttttgtagaagtattgatcaat----aaaaaatgcaatgcatggtttttgttttgctttcattcactttattcaatgcctcttttatgtgagt |
9072759 |
T |
 |
| Q |
201 |
ttttcattcatgtaatcatcta |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9072758 |
ttttcattcatgtaatcatcta |
9072737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University