View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18634_low_18 (Length: 214)
Name: NF18634_low_18
Description: NF18634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18634_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 32620012 - 32619840
Alignment:
| Q |
20 |
attgatgatttatttttctcgaggttgaatgtagttgatattgacatgtacatttaggatgatcaaatatatttcattcttgcaaaaatggaatgataca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32620012 |
attgatgatttatttttctcgaggttgaatgtagttgatattgacatttacatttaggatgatcaaatatatttcattcttgcaaaaatggaatgataca |
32619913 |
T |
 |
| Q |
120 |
ctcctctaaacgaaggcacatgtctttattcaacttagaagtggttgaaagatatttagtttatcataaactt |
192 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32619912 |
ctcctctaaacgaagacacatgtctttattcaacttagaagtggttgaaagatatttagtttatcataaactt |
32619840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University