View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18635_high_8 (Length: 336)
Name: NF18635_high_8
Description: NF18635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18635_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 31151447 - 31151402
Alignment:
| Q |
166 |
gcatgtatagataggaggataaaaagttgtagggagatttgatatg |
211 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
31151447 |
gcatgtatagataggaggataaaaaattgtaggcagatttgatatg |
31151402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 269 - 321
Target Start/End: Complemental strand, 31202248 - 31202196
Alignment:
| Q |
269 |
attttaggatgtctttggtgacattaatgtatgtgaattctaaccaagattct |
321 |
Q |
| |
|
||||||| ||||||||| ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
31202248 |
attttagcatgtctttgatgatattaatgtttgtgaattctaaccaagattct |
31202196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 312
Target Start/End: Complemental strand, 31151221 - 31151191
Alignment:
| Q |
282 |
tttggtgacattaatgtatgtgaattctaac |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31151221 |
tttggtgacattaatgtatgtgaattctaac |
31151191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 166 - 208
Target Start/End: Complemental strand, 31190672 - 31190631
Alignment:
| Q |
166 |
gcatgtatagataggaggataaaaagttgtagggagatttgat |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
31190672 |
gcatgtata-ataggaggataaaaagttgcagggagatttgat |
31190631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 269 - 321
Target Start/End: Complemental strand, 31172719 - 31172667
Alignment:
| Q |
269 |
attttaggatgtctttggtgacattaatgtatgtgaattctaaccaagattct |
321 |
Q |
| |
|
||||||| ||||||||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
31172719 |
attttagcatgtctttgagaacattaatgtttgtgaattctaaccgagattct |
31172667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University