View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18635_low_16 (Length: 202)
Name: NF18635_low_16
Description: NF18635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18635_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 9500187 - 9500357
Alignment:
| Q |
18 |
agtttgtacttggtagacctgtcgtattgatttaacattatgccttcaattttgtttcttcaatttttgagcatttatatgcatgtattataagttactc |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500187 |
agtttgtacttggtagccctgtcgtattgatttaacattacgccttcaaatttttttcttcaatttttgagcatttatatgcatgtattataagttactc |
9500286 |
T |
|
| Q |
118 |
gagttgtctgcataagcttcagttgacatatcaattatcaaaaatatattttatgatttgtgtatgaaacaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
9500287 |
gagttgtctgcataagcttcagttgacatatcaattatc-aaaatatattttatgatttgtgtatgtaacaa |
9500357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University