View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18636_high_24 (Length: 276)
Name: NF18636_high_24
Description: NF18636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18636_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 53984506 - 53984255
Alignment:
| Q |
18 |
aaaagtaatttctctaaccaccaaaaaataatccatgttttatatttaggctagagaaagaaatcgacccacaaaaggggtgaacttgcagggtttcttt |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53984506 |
aaaagtaatttctctaagcaccaaaaaataatccatgttttatatttaggctagagaaagaaatcgacccacaaaaggggtgaacttgcagggtttcttt |
53984407 |
T |
|
| Q |
118 |
ccttccgggtgtggagggaataatattatgtttgtaa-nnnnnnnnnnnnnnnnnnncaacatgcatgatttttactcacgtctcctattattctcatca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53984406 |
ccttccgggtgtggagggaataatattatgtttgtaatttttttttttttactttttcaacatgcatgatttttactcacgtctcctattattctcatca |
53984307 |
T |
|
| Q |
217 |
tatatcttacttaatttcctccctttttggtttctttttagccattcatctc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53984306 |
tatatcttacttaatttcctccctttttggtttctttttagccattcttctc |
53984255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University