View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18636_low_23 (Length: 289)
Name: NF18636_low_23
Description: NF18636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18636_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 131 - 270
Target Start/End: Complemental strand, 11832245 - 11832106
Alignment:
| Q |
131 |
gatcattattattgtcggtattagttacgcttcgacaaatagaaaatttaacaagctccgagtattctgctgcatgaaaggtttcaaactgaattcatga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11832245 |
gatcattattattgtcggtattagttacgcttcgacaaatagaaaatttaacaagctccgagtattctgctgcatgaaaggtttcaaactaaattcatga |
11832146 |
T |
 |
| Q |
231 |
aagtaaaatcctctcaaatagaattatttgatactcattt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11832145 |
aagtaaaatcctctcaaatagaattatttgatactcattt |
11832106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 11832374 - 11832340
Alignment:
| Q |
1 |
aagagaagaggaataataattgatttttagtgaac |
35 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11832374 |
aagagaagaggaataataagtgatttttagtgaac |
11832340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University