View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18636_low_28 (Length: 247)
Name: NF18636_low_28
Description: NF18636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18636_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 16440766 - 16441007
Alignment:
| Q |
1 |
ttcatctttccctgatatgtttcaatgccacatggaactatgggtcatatttagatattctaccgaaacaaattagtattctattaattaactaccaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16440766 |
ttcatctttccctgatatgtttcaatgccacatggaactatgggtcatatttagatattctactgaaacaaattagtattctattaattaactaccaatt |
16440865 |
T |
 |
| Q |
101 |
caatccccaaaaaacccaagtgaaatcacaaccgaaattatgtaacgtttatgcccataatgcattttgctccctaactagtatgcctcaattgaaacct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16440866 |
caatccccaaaaaacccaagtgaaatcacaacccaaattatgtaacgtttatgcccataatgcattttgctccctagctagtatgcctcaattgaaacct |
16440965 |
T |
 |
| Q |
201 |
caaagtcttaatacaacatcaaactatccacaggttctgctc |
242 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||| |||| |
|
|
| T |
16440966 |
caaagtcttaatacaacatcaaactattcacagcttcagctc |
16441007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University