View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18636_low_30 (Length: 242)
Name: NF18636_low_30
Description: NF18636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18636_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 9567738 - 9567968
Alignment:
| Q |
1 |
tgcttgagagcatgcaaaagtaacatccactgtgatccttgtgcaatttggaagtcaattatgtgaattcttgattcatttttcatttcttcacaaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9567738 |
tgcttgagagcatgcaaaagtaacatccactgtgatccttgtgcaatttggaagtcaattatgtgaattcttgattcattttgcatttcttcacaaatga |
9567837 |
T |
|
| Q |
101 |
cagcattggatgatatataagcaaactgaaaatatgggcaaatctgatacaaaatgtgcatagcacttatcaactctatgcttgttggttcttcacattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9567838 |
cagcattggatgatatataagcaaactgaaaatatgggcaaatctgatacaaaatgtgcatagcactcatcaactctatgcttgttggttcttcacattt |
9567937 |
T |
|
| Q |
201 |
caaggctttataaattgcactccctgatgat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9567938 |
caaggctttataaattgcactccctgatgat |
9567968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 31 - 203
Target Start/End: Original strand, 55913614 - 55913786
Alignment:
| Q |
31 |
tgtgatccttgtgcaatttggaagtcaattatgtgaattcttgattcatttttcatttcttcacaaatgacagcattggatgatatataagcaaactgaa |
130 |
Q |
| |
|
|||| ||| ||||| |||||||| |||||||| ||||| || ||||||||| |||| ||||| |||| |||||||| | ||||| || ||||||| || |
|
|
| T |
55913614 |
tgtgttccctgtgcgatttggaaatcaattatatgaatcctggattcatttgccattgcttcagaaataacagcatttgcagatatgtatgcaaacttaa |
55913713 |
T |
|
| Q |
131 |
aatatgggcaaatctgatacaaaatgtgcatagcacttatcaactctatgcttgttggttcttcacatttcaa |
203 |
Q |
| |
|
||||||| ||||||||||||| |||||||| | | || | |||| |||| ||||||| |||||||||||| |
|
|
| T |
55913714 |
aatatggacaaatctgatacagcatgtgcatgtaagtcattagctctttgctcgttggttgttcacatttcaa |
55913786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University