View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18636_low_31 (Length: 238)
Name: NF18636_low_31
Description: NF18636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18636_low_31 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 9567446 - 9567668
Alignment:
| Q |
16 |
cagtctcaaaagcctgtctctatgattctccatgctcacgctctcgtccggtatgtgatgcaaagcaaaaggaaaattcacaacaagaacttcatcatgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9567446 |
cagtctcaaaagcctgtctctatgattctccatgctcacgctctcgtccggtatgtgatgcaaagcaaaaggaaaattcacaacaagaacttcatcatgt |
9567545 |
T |
 |
| Q |
116 |
tgaacttcaaaatcttccagttgaacctcacatccatacattttaacactattgaactcaaatggaactttacaagtttttgcacaatcttctagctttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9567546 |
tgaacttcaaaatcttccagttgaacctcacatccatacattttaacactattgaactcaaatggaactttacaagtttttgcacaatcttctagctttt |
9567645 |
T |
 |
| Q |
216 |
ttcctacaatatcaagttttcca |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9567646 |
ttcctacaatatcaagttttcca |
9567668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University