View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18636_low_32 (Length: 237)
Name: NF18636_low_32
Description: NF18636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18636_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 43307832 - 43308038
Alignment:
| Q |
17 |
caatgaagatatcaaagtagcgtctttcatacaatac------aatgtcgaacttatttgagagtgtcttataaaatcatgcaaaacacatatttgaatg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43307832 |
caatgaagatatcaaagtagcgtctttcatacaatacatatacaatgtcgaacttatttgagagtgtcttataaaatcatgcaaaacacatatttgaatg |
43307931 |
T |
|
| Q |
111 |
aaatatatatacggacctgatagttataggtgactccgcaaagagtgttattaaacagatagcatccaaagttctttcatgatgttttcgggaactttac |
210 |
Q |
| |
|
|| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43307932 |
aa----atatacggacctgatagttataggtgacaccgcaaagagtgttatt-aacagatagcatccaaagttctttcatgatgttttcgggaactttac |
43308026 |
T |
|
| Q |
211 |
aaaggtatttgt |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43308027 |
aaaggtatttgt |
43308038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University