View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18636_low_9 (Length: 463)
Name: NF18636_low_9
Description: NF18636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18636_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 315; Significance: 1e-177; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 21 - 367
Target Start/End: Complemental strand, 31406609 - 31406263
Alignment:
| Q |
21 |
actgggacttccaaatgttgtggatcatgcaagaaatattcaccctgagcttgtcctagctgctgctgattctgctgatattgcagaagcttaattattg |
120 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31406609 |
actgggacttccaaatgctgtggatcatgcaggaaatattcaccctgagcttgtcctagctgctgctgattctgctgatattgcagaagcttaattattg |
31406510 |
T |
|
| Q |
121 |
ttaccatattaactatttagttaatagtatcgaagtgctagtagccagaaataaaactttgtctttgttgtttgttagtcactattatgggcaggttgat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31406509 |
ttaccatattaactatttagttaatagtatcgaagtgctagtaaccagaaataaaactttgtctttgttgtttgttagtagtgattatgggcaggttgat |
31406410 |
T |
|
| Q |
221 |
gtgactctctatgagcttttttgtcattaatatgaatgaatgtgtttgccaactccttgcatttctttctcctccactaatatttatgattgttttttaa |
320 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31406409 |
gtgactctgtatgagcttttttgtcattaatatgaatgaatgtgtttgccaactccttgcatttctttctcctccactaatatttatgattgttttttaa |
31406310 |
T |
|
| Q |
321 |
tgaaaagggaatactattaaggggacagaattcccccaatcctccca |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31406309 |
tgaaaagggaatactattaaggggacagaattcccccaatcctccca |
31406263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 365 - 453
Target Start/End: Complemental strand, 31405891 - 31405803
Alignment:
| Q |
365 |
ccaactggatatttctgcatcttagatagggtttcctactattttcctctatactagcacttgatcaaggccttcacatttggtctgtg |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31405891 |
ccaactggatatttctgcatcttagatagggtttcctactattttcctctatactagcacttgatcaaggccttcacatttggtctgtg |
31405803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University