View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18637_low_14 (Length: 284)
Name: NF18637_low_14
Description: NF18637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18637_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 9 - 267
Target Start/End: Original strand, 51936849 - 51937097
Alignment:
| Q |
9 |
gaagaatatcgatatctgctacatgtacaaacggatgtgttccctatttggacttcatagataatgggataatgatctggttatggcctaaggttgtcct |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51936849 |
gaagaatatcgatatctgctacatgtacaaacggatgtgttccctatttggacttcatagata--------atgatctggttatggcctaaggttgtcct |
51936940 |
T |
|
| Q |
109 |
gacagaaaacctgcaatatgcatctacatgcagctggaatggataaagcaaaatttgatagcacaattgnnnnnnnnnnnnnnnnnntgtagtagaggtg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
51936941 |
gacagaaaacctgcaatatgcatctacatgcagctggaatggataaagcacaatttgatagcacaattg--aaaaaaaaaataaaaatgtagtagaggtg |
51937038 |
T |
|
| Q |
209 |
agactaattgaaaggaaatttctttgaaggactaattgaaagtaaattgttataagtac |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937039 |
agactaattgaaaggaaatttctttgaaggactaattgaaagtaaattgttataagtac |
51937097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University