View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18637_low_17 (Length: 263)
Name: NF18637_low_17
Description: NF18637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18637_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 46309207 - 46309277
Alignment:
| Q |
1 |
ttcttttcttaggtttatcgtgaaaatccaaaaaatcaattagctttttcttattcatatgttcatcatca |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
46309207 |
ttcttttcttaggtttatcgtgaaaatccaaaaaagcagttagctttttcttattcatatgttcatcatca |
46309277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 205 - 263
Target Start/End: Original strand, 46309408 - 46309466
Alignment:
| Q |
205 |
catctcaagtaattttgtcaatattattatatggatctcactaataactttacaagtcc |
263 |
Q |
| |
|
|||||| | |||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46309408 |
catctcgaataattttgtcgatattattttatggatctcactaataactttacaagtcc |
46309466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 121 - 157
Target Start/End: Original strand, 46309324 - 46309360
Alignment:
| Q |
121 |
tatttatttgtgcatgttttttaggatgaaggactcc |
157 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46309324 |
tatttatttgtgcatgttttttaggattaaggactcc |
46309360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University