View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18637_low_25 (Length: 211)
Name: NF18637_low_25
Description: NF18637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18637_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 11689767 - 11689593
Alignment:
| Q |
18 |
catgtcatggttaaaagaacattggtgcttactattttcaggtcctacctcatttgggccaatagttgaaatggccatgacaattgttgagcagagtggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11689767 |
catgtcatggttaaaagaacattggtgcttactattttcaggtcctacctcatttgggccaatagttgaaatggccatgacaattgttgagcagagtggg |
11689668 |
T |
|
| Q |
118 |
ggtcagtaccatgttttggtgataatagcagatggccaggtattctttcaactcgatttcctttacgacattaat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11689667 |
ggtcagtaccatgttttggtgataatagcagatggccaggtattctttcaactcaatttcctttacgacattaat |
11689593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 55 - 163
Target Start/End: Original strand, 7473512 - 7473620
Alignment:
| Q |
55 |
tcaggtcctacctcatttgggccaatagttgaaatggccatgacaattgttgagcagagtgggggtcagtaccatgttttggtgataatagcagatggcc |
154 |
Q |
| |
|
||||| ||||| ||||||| || || ||||||| ||||||||||||||||||||||||||| || || |||||||||||||||||||| || ||||||| |
|
|
| T |
7473512 |
tcaggccctacatcatttgcacccattgttgaaacggccatgacaattgttgagcagagtggaggccaataccatgttttggtgataattgctgatggcc |
7473611 |
T |
|
| Q |
155 |
aggtattct |
163 |
Q |
| |
|
||||||||| |
|
|
| T |
7473612 |
aggtattct |
7473620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University