View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18638_high_24 (Length: 235)
Name: NF18638_high_24
Description: NF18638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18638_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 41735545 - 41735321
Alignment:
| Q |
1 |
agaataaccggagtcaattgattattacgtaccattccataatattcctgcagtttttacagtaccaaactactaattcttccttctccacaatcactta |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41735545 |
agaataactggagtcaattgattattacgtaccattctataatattcctgcagattttacaataccaaactactaattctcccttctccacaatcacttg |
41735446 |
T |
|
| Q |
101 |
tacatttagggtaaaaacaattaatag----gatgcactcatgaatcatgagtcatgaggatgcttcaaagtcttggaggggatatggtgtgatgagtac |
196 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735445 |
tacatttacggtaaaaacaattaataggatggatgcactcatgaatcatgagtcatgaggatgcttcaaagtcttggaggggatatggtgtgatgagtac |
41735346 |
T |
|
| Q |
197 |
catgaccttatgtctatgcaataat |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41735345 |
catgaccttatgtctatgcaataat |
41735321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University