View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18638_high_6 (Length: 561)
Name: NF18638_high_6
Description: NF18638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18638_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 2e-29; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 421 - 499
Target Start/End: Complemental strand, 8097014 - 8096936
Alignment:
| Q |
421 |
gcagaaggatgatagtgtactattattcgaagaaacaaaatagtggaggcttgtttatggaatgtaaattcttcctcaa |
499 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
8097014 |
gcagaaggatgatagtgcactattattcgaagaaacaaaatagtggaggcttgtttatggaatctaaattctttctcaa |
8096936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 8097213 - 8097156
Alignment:
| Q |
1 |
aaaataagattatacctgacaaaaaagatcaaggatggtattatcggatggtattatc |
58 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8097213 |
aaaacaagattgtacctgacgaaaaagatcaaggatggtattatcggatggtattatc |
8097156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 493 - 537
Target Start/End: Complemental strand, 8096421 - 8096378
Alignment:
| Q |
493 |
tcctcaacctttagtctgttttatttgctgttaatccatccactt |
537 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| |||||||||||| |
|
|
| T |
8096421 |
tcctcaacctttagtctgtattatttgttgtt-atccatccactt |
8096378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 247 - 279
Target Start/End: Complemental strand, 8097076 - 8097044
Alignment:
| Q |
247 |
gctttcaaaaaccttttccccatatggtatatc |
279 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
8097076 |
gctttcaaaaaccttttcaccatatggtatatc |
8097044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University