View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18638_low_21 (Length: 257)
Name: NF18638_low_21
Description: NF18638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18638_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 47270815 - 47271017
Alignment:
| Q |
18 |
tgatctcgatcaaacagccaacgatgtgctggccgtgtgaatgtatgaaattgtcgcaacaaatccaaatccagggaatcacttaccttccacgttcact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47270815 |
tgatctcgatcaaacagccaacgatgtgctggccgtgtgaatgtgtgaaattgtcgcaacaaatccaaatccagggaatcacttaccttccacgttcact |
47270914 |
T |
 |
| Q |
118 |
gtctggaagatttatatatcgttctaggatttcttcaatgcttcaaagcatatattaaaaagtgagaataagttcatttatttatatattc-aatcattt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
47270915 |
gtctggaagatttatatatcgttctaggatttcttcaatgcttcaaagcatatattaaaaagtgagaataagttcatttatttatacattcaaatcattt |
47271014 |
T |
 |
| Q |
217 |
tgt |
219 |
Q |
| |
|
||| |
|
|
| T |
47271015 |
tgt |
47271017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University