View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18638_low_24 (Length: 238)
Name: NF18638_low_24
Description: NF18638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18638_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 221
Target Start/End: Original strand, 32691892 - 32692096
Alignment:
| Q |
17 |
atatcaattgaactcgtacagatcatttgttcattaaaaaagtatgtacactgtagcacaacgtttctgattgaaagtgtgtcttgtgtcccgacatgtg |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32691892 |
atatcaattgaacttgtacagatcatttgttcattaaaaaagtatgtacattgtagcacaacgtttctgattgaaagtgtgtcttgtgtctcgacatgtg |
32691991 |
T |
 |
| Q |
117 |
tcagcgcgtgacgtctaaattaattgattttcataaattatcatcgtcggtgtctgcgcttcataggtacattgtagttaaagttgataaattgcacctg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32691992 |
tcagcgcgtgacgtctaaattaattgattttcataaattatcatcgtcggtgtctgcgcttcataggtacattgtagttaaagttgataaattgcacctg |
32692091 |
T |
 |
| Q |
217 |
gtgag |
221 |
Q |
| |
|
||||| |
|
|
| T |
32692092 |
gtgag |
32692096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University