View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18638_low_26 (Length: 238)
Name: NF18638_low_26
Description: NF18638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18638_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 17 - 170
Target Start/End: Complemental strand, 43291056 - 43290903
Alignment:
| Q |
17 |
cacacccaccttctaagtttccaacactaggtttatcattctctttcccctttagacaacaataaattataaaaaataatttaacatcgtgcattggcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43291056 |
cacacccaccttctaagtttccaacactaggtttatcattctctttcccctttagacaacaataaattataaaaaataatttaacatcgtgcattggcat |
43290957 |
T |
|
| Q |
117 |
tgttaaaatggttttaagttgagaaatgatatttacacatccaccttgtgacaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| || |||||| |
|
|
| T |
43290956 |
tgttaaaatggttttaagttgagaaatgatatttgtacatccactttatgacaa |
43290903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University