View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18638_low_28 (Length: 229)
Name: NF18638_low_28
Description: NF18638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18638_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 6 - 211
Target Start/End: Original strand, 49020694 - 49020900
Alignment:
| Q |
6 |
gatgtcgaagaaaatggtcaatgcagttgagccacttggactcaaatgtaggagtcgtgccgtggatcggttcccggcggctgatatggttgtttttcaa |
105 |
Q |
| |
|
||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49020694 |
gatgttgaagaagatggtgaatgcagttgagccacttggactcaaatgtaggagtcgtgccgtggatcggtttccggcggctgatatggttgtttttcaa |
49020793 |
T |
 |
| Q |
106 |
acttttacggctcgccggagaaatgtttaatgcccgcgaggtggtggttgtggtggtggaggg-aaaaaattaagtaagattagtgaattggttttagag |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49020794 |
acttttacggctcgccggagaaatgtttaatgcccgcgaggtggtggttgtggtggtggagggaaaaaaattaagtaagattagtgaattggttttagag |
49020893 |
T |
 |
| Q |
205 |
ttagttg |
211 |
Q |
| |
|
||||||| |
|
|
| T |
49020894 |
ttagttg |
49020900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University