View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18638_low_9 (Length: 447)
Name: NF18638_low_9
Description: NF18638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18638_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 45641960 - 45642159
Alignment:
| Q |
17 |
aattagcaactgaaacacaagtctttgttactgttgttcagttggattgagtggcatgctctgattcttatgtatatgtttttgaggatatatgttaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45641960 |
aattagcaactgaaacacaagtctttgttactgtcgttcagttggattgagtggcatgctctgattcttatgtatatgtttttgaggatatatgttaatg |
45642059 |
T |
 |
| Q |
117 |
cctcacatattttaatcttcatatatttggaaagctgtagagaacttagaaacaaaatttgcattctggattgtatacttgggtcatagattggtatggc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45642060 |
cctcacatattttaatcttcatatatttggaaagctgtagagaacttagaaacaaaatttgcattctggattgtatacttggctcatagattggtatggc |
45642159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 279 - 434
Target Start/End: Original strand, 45642222 - 45642377
Alignment:
| Q |
279 |
gactgatgacattaaagggttccaatgataataactatgcaatcagtattctattgttctctgctgttgtttgtattataattatcgaaaaatgttggac |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45642222 |
gactgatgacattaaagggttccaatgataataactatgcaatcagtattctattgttctctgctgttgtttgtattataattatcgaaaaatgttggac |
45642321 |
T |
 |
| Q |
379 |
cctcttctgttaatgctgatgaagtatttggccagatttcttttgatgccgtccct |
434 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
45642322 |
cctcttctgttaatgctgatgcagtatttggccagatttcttttgatgccatccct |
45642377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University