View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18639_high_14 (Length: 250)
Name: NF18639_high_14
Description: NF18639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18639_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 6 - 139
Target Start/End: Complemental strand, 35219211 - 35219078
Alignment:
| Q |
6 |
tgtcgaagaaaatgaaaggaaaataattgtgatggggcaaatggaaagaagttaataagaagggaagataagcgagggctgctgtctattgtctaatgat |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35219211 |
tgtccaagaaaatgaaaggaaaataattgtgatggggcaaagggaaagaagttaataagaagggaagataagcgagggctactgtctattgtctaatgat |
35219112 |
T |
|
| Q |
106 |
agtcccagccgacactaggcgcgtgttgtgtgcc |
139 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
35219111 |
agtcccagccgacactaggcgcgtgttgtttgcc |
35219078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 196 - 250
Target Start/End: Complemental strand, 35219009 - 35218955
Alignment:
| Q |
196 |
gaaataaacatgtaagaacctttggataagatggtaaaagatttctttaatttta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35219009 |
gaaataaacatgtaagaacctttggataagatggtaaaagatctctttaatttta |
35218955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University