View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18639_high_15 (Length: 242)
Name: NF18639_high_15
Description: NF18639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18639_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 26657635 - 26657861
Alignment:
| Q |
1 |
atttcattgtttgatcatgtgaaatgtcaaatttctgcctgtcttttcatttgagtgataaaccttgatctgtatttggtgtttacacttttcaccgttg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26657635 |
atttcattgtctgatcatgtgaaatgtcaaatttctgcctgtcttttcatttgagtgataaaccttgatctgtatttggtgtttacacttttcactgtta |
26657734 |
T |
|
| Q |
101 |
aaagaacaagttgattgcac-ttacaccatataatatttgtaaagctgattcggtggggttataaagtgaatgggttggtttagaaggtaagagttggaa |
199 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26657735 |
aaagaacaagttgattgcactttacatcatataatatttgtaaagctgattcggtggggttataaagtgaatgggttggtttagaaggtaagagttggaa |
26657834 |
T |
|
| Q |
200 |
tgatcagaaggtaactctggtccttct |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
26657835 |
tgatcagaaggtaactctggtccttct |
26657861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University