View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18639_high_16 (Length: 239)
Name: NF18639_high_16
Description: NF18639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18639_high_16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 6416059 - 6416279
Alignment:
| Q |
19 |
tgatgagcgtgagagggtgtaatgagaaaaactcaaatcccacacaggatacagtcctcaccttataaatca-ttttgtaaaaatgagttaggtcacata |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6416059 |
tgatgagcgtgagagagtgtaatgagaaaaactcaaatcccacacaggatacaatcctcatcttataaatcagttttgtaaaaatgagttaggtcacata |
6416158 |
T |
 |
| Q |
118 |
tttcaccggtatttacttattatcttttttctgaaacctacnnnnnnnctttaatctctaaccaaccaaaaaggctgttagtttatgtgcttgactctca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6416159 |
tttcaccggtatttacttattatcttttt-ctggagcctactttttttctttaatctctaaccaaccaaaaaggctgttagtttatgtgcttgactctca |
6416257 |
T |
 |
| Q |
218 |
tgtttgaacattgttctgtttt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6416258 |
tgtttgaacattgttctgtttt |
6416279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University