View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18639_high_4 (Length: 438)
Name: NF18639_high_4
Description: NF18639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18639_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 38 - 416
Target Start/End: Complemental strand, 35218588 - 35218217
Alignment:
| Q |
38 |
aaagggaaatgctattacatatactaaaatataaaattatgctaatttatttgtcaacaagttgaaaaataattcttttttcaataattacttaatattt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35218588 |
aaagggaaatgctattacatatactaaa-tataaaattgtgctaatttatttgtcaacaagttgaaaaataatttttttttcaataattacttaatattt |
35218490 |
T |
 |
| Q |
138 |
gttgaatcttttgggtacatattaacatgaacctttttcaaaatttaaaaagaattgtatcacaagcacatgattttgttatcgacctattttatacttc |
237 |
Q |
| |
|
||||||||||| ||| || |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35218489 |
gttgaatctttagggc------taggatgaacttttttaaaaatttaaaaagaattgtatcacaagcacatgattttgttatcgacctattttatacttc |
35218396 |
T |
 |
| Q |
238 |
actagcaacaaaaatgtataatctcaactactttttaaacatttattttgttgatgatttttgctacttcattaaccataaaactgcaagtcattaacca |
337 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35218395 |
actagcaacaaaaatgtataatatcaactactttttaaacatttattttgttgatgatttttgctacttcattaaccataaaactgcaagtcattaacca |
35218296 |
T |
 |
| Q |
338 |
gttatttgacaaaatgacagaagtacgtagatttttgaggttaatgaagtactcaaattggttaataagatatgtggtt |
416 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35218295 |
gttatttgacaaaatgacagaagtacctagattttttaggttaatgaagtactcaaattgtttaataagatatgtggtt |
35218217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University