View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18639_low_19 (Length: 219)
Name: NF18639_low_19
Description: NF18639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18639_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 9 - 148
Target Start/End: Original strand, 36743785 - 36743924
Alignment:
| Q |
9 |
ctttacaaatctacttccagttgttgcaccatgtttgattttctagtggcactatagtcgtagcgaaattttaacaaactggtattgttttgcaatttgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36743785 |
ctttacaaatctacttccagttgttgcaccatgtttggttttctagtggcactatagtcgtagcggaattttaacaaactggtattgttttgcaatttgt |
36743884 |
T |
 |
| Q |
109 |
gggttgattttggtttgttactgtcatctatgttaagaca |
148 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
36743885 |
gggttgattttggtttgttactgtcatttatcttaagaca |
36743924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 36743923 - 36743969
Alignment:
| Q |
173 |
cattttttggctagtttctgcagacaagtaacttgtttaagtgaaac |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36743923 |
cattttttggctagtttctgcagacaagtaacttgtttaagtgaaac |
36743969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University