View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18639_low_5 (Length: 435)
Name: NF18639_low_5
Description: NF18639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18639_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 393; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 393; E-Value: 0
Query Start/End: Original strand, 13 - 416
Target Start/End: Original strand, 3983502 - 3983903
Alignment:
| Q |
13 |
aatatattgaaaccagtagttcatatcaaaacacaaagacattactgcatttctatgatcccattgtgatcatcgttcctccaaacaagtcagcctccag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3983502 |
aatatattgaaaccagtagttcatatcaaaacacaaagacattactgcatttctatgatcccattgtgatcatcgttcctccaaacaagtcagcctccag |
3983601 |
T |
 |
| Q |
113 |
ttctacaagtacagttactgaattggttgatagattttatggttcagtcaagaaggtaatatgatcatgtctctttgtccttacatccttctaatggtta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3983602 |
ttctacaagtacagttactgaattggttgatagattttatggttcagtcaagaaggtaatatgatcatgtctctttgtccttacatccttctaatggtta |
3983701 |
T |
 |
| Q |
213 |
tgtttttcagtgcaaaactgctgtgcatgatgtctgtctatgaaatacatttcatttggagttcttttatatgcaggtagtgttggcccgtggttgtttt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3983702 |
tgtttttcagtgcaaaactgctgtgcatgatgtctg--tatgaaatacatttcatttggagttcttttatatgcaggtagtgttggcccgtggttgtttt |
3983799 |
T |
 |
| Q |
313 |
gatgacacaaaggttttagcacatactttttatctttcatttcaattgatttcaaggtttaggattctatagcaaattttttcctcagaaatgcactaaa |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3983800 |
gatgacacaaaggttttagcacatactttttatctttcatttcaattgatttcaaggtttaggattctatagcaaattttttcctcagaaatgcactaaa |
3983899 |
T |
 |
| Q |
413 |
tttt |
416 |
Q |
| |
|
|||| |
|
|
| T |
3983900 |
tttt |
3983903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University