View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18639_low_7 (Length: 406)
Name: NF18639_low_7
Description: NF18639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18639_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 20 - 396
Target Start/End: Original strand, 3592545 - 3592917
Alignment:
| Q |
20 |
caaccgacttttattgtggtttggttattttggcagttcgatcacgggcggttcaagacggttgaatcatgatctagaagtctcacctgttcgatgtcca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3592545 |
caaccgacttttattgtggtttggttattttggcagttcgatcacgggcggttcaacacggttgaatcatgatctagaagtctcacctgttcgatgtcca |
3592644 |
T |
|
| Q |
120 |
gttcaggttttaaaccattgctttgatataaaaatatnnnnnnnntgatttgttaacacatggtagtttagtgtctaatgtccataggttagttatttac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3592645 |
gttcaggttttaaaccattgctttgatataaaaaaa----aaaaatgatttgttaacacatggtagtttagtttctaatgtccataggttagttatttac |
3592740 |
T |
|
| Q |
220 |
ttggggtgttgtgtttttgatacagattagtaagtgttcttgttctcatatggaacatattatgcagtggtgtatgagtatttggagctgacttatttta |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3592741 |
ttggggtgttgtgtttttgatacagattagtaagtgttcttgttctcatatggaacatattatgcagtggtgtatgagtatttggagctgacttatttta |
3592840 |
T |
|
| Q |
320 |
gtttcagcttcagattcaagcaagagggtctaattaatattaatgtaatccactgtgtttacctacctattcctatg |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3592841 |
gtttcagcttcagattcaagcaagagggtctaattaatattaatgtaatccactgtgtttacctacttattcctatg |
3592917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University