View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_high_101 (Length: 236)
Name: NF1863_high_101
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_high_101 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 46910136 - 46909915
Alignment:
| Q |
1 |
tgcactcatcctcttactattcaagtgtttcagtgcatgcgcttcattgaattaccgggctttcaattatctcccatttctgtcaatgcaatactgtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46910136 |
tgcactcatcctcttactattcaagtgtttcagtgcatgcgcttcattgaattaccgggctttcaattatctcccatttctgtcaatgcaatactgtttt |
46910037 |
T |
|
| Q |
101 |
acacttacaatgcattaaccaaagtagggtagcgtgacaaattattagattttcatttagatgnnnnnnnntgtatggcatgtcaggtatatatgcaaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46910036 |
acacttacaatgcattaaccaaagtagggtagcgtgacaaattattagattttcatttagatgaaaaaaaatgtatggcatgtcaggtatatatgcaaag |
46909937 |
T |
|
| Q |
201 |
tgagaatgagaccaggattctg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46909936 |
tgagaatgagaccaggattctg |
46909915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University