View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_high_103 (Length: 235)
Name: NF1863_high_103
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_high_103 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 41862246 - 41862465
Alignment:
| Q |
1 |
actgcccatcaggactaaatttcatggtcaaaattgcaccttcatgcgcttgaatatcttgcctcaagtaaagcgatgaaagttccttcattttcttcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41862246 |
actgcccatcaggactaaatttcatggtcaaaattgcaccttcgtgcgcttgaatatcttgcctcaagtaaagtgatgaaagttccttcattttcttcct |
41862345 |
T |
 |
| Q |
101 |
acattgacggacctttactttctgaagcctacaccctgagactgcataactcccttcttctctatcattatcaaccacgcacgtcatcgatctcaatctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41862346 |
acattgacggacctttactttctgaagcctacaccctgagactgcataactcccttcttttctatcattatcaaccacgcacgtcatcgatctcaatctt |
41862445 |
T |
 |
| Q |
201 |
ctcaaccaaccccttcttgc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41862446 |
ctcaaccaaccccttcttgc |
41862465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 9 - 133
Target Start/End: Complemental strand, 530665 - 530541
Alignment:
| Q |
9 |
tcaggactaaatttcatggtcaaaattgcaccttcatgcgcttgaatatcttgcctcaagtaaagcgatgaaagttccttcattttcttcctacattgac |
108 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||| || |||||||||||||| | || ||||| | ||||||||||||| ||| ||| | ||||||| |
|
|
| T |
530665 |
tcaggactaaatttcatggtaaaaattggaccttcgtgtgcttgaatatcttgtcccatataaagagctgaaagttccttcctttgtttcttgcattgac |
530566 |
T |
 |
| Q |
109 |
ggacctttactttctgaagcctaca |
133 |
Q |
| |
|
| ||||| ||| ||||| |||||| |
|
|
| T |
530565 |
gaaccttaactcgctgaatcctaca |
530541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University