View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_high_111 (Length: 218)
Name: NF1863_high_111
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_high_111 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 200
Target Start/End: Complemental strand, 38793457 - 38793267
Alignment:
| Q |
10 |
agattattctgcatgattggttaaataaaaataacgggattatccaacaattaaattttaaattatataaaatattagtattttattattgggtaaaggg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38793457 |
agattattctgcatgattggttaaataaatataacgggattatccaacaattaaattttaaattatataaaatattagtattttattattgggtaaaggg |
38793358 |
T |
 |
| Q |
110 |
ttgtactattgtataagaagataccaaggggtccgtccaatacaatggtgaagaataaaatggaggacacttcaaaaatgaagcaaagaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38793357 |
ttgtactattgtataagaagataccaaggggtccgtccaatacaatggtgaagaataaaatggaggacacttcaaaaatgaagcaaagaca |
38793267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University