View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_high_112 (Length: 218)
Name: NF1863_high_112
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_high_112 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 6374031 - 6373816
Alignment:
| Q |
12 |
tcttcattagtagttagggccttcaacaatgattccatgattcctggcgatttaagaaacggatggttgaattgcaagaatcgcctttatcatataaaat |
111 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6374031 |
tcttcattagtagttatggccttcaacaatgattccatgattccttgcgatttaagaaacagatggttgaattgcaagaatctcctttatcatataaaat |
6373932 |
T |
|
| Q |
112 |
gttttgaggtagcagcactttgttgcacctctttttggtt-----------taaaaaatagatgatccctaaaacaattagggtggaaaagggaaatggt |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6373931 |
g--ttgaggtagcagcactttgttgcacctctttttggtttaaaaaataaataaaaaatagatgatccctaaaacaattagggtggaaaagggaaatggt |
6373834 |
T |
|
| Q |
201 |
acataagaataccgagac |
218 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
6373833 |
acataagaatactgagac |
6373816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University