View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_high_36 (Length: 383)
Name: NF1863_high_36
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_high_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 142 - 374
Target Start/End: Original strand, 5728559 - 5728774
Alignment:
| Q |
142 |
tcaacatatttcattcattcaaccgggatacaaatctatctatatgcccttttcttcattatggatattaaaaactaaaaataagttaagggaccgaaca |
241 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5728559 |
tcaacatatttcattcattcaacctggatacaaatctatgtatatgcccttttcttcattatggatattaaaaactaaaaataagttaagggaccgaata |
5728658 |
T |
 |
| Q |
242 |
atgtatcacatcgaattaaaagccagtcccttgacnnnnnnnctcttcttttcaattatcgcactatatcaacttcaattctcaccctaatgcccataag |
341 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5728659 |
atgtatcacatcgaattaaaaatcagtcgcttgac-ttttttctcttcttttcaattatcgc----------------ttctcaccctaatgcccataag |
5728741 |
T |
 |
| Q |
342 |
agtttttattctacccatcacatgtacctttgc |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5728742 |
agtttttattctacccatcacatgtacctttgc |
5728774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 5728414 - 5728460
Alignment:
| Q |
1 |
ttttggcagattgtgcaaagc---agatgatgtggcatgttgagtag |
44 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5728414 |
ttttggcagattgtgcaaagcagaagatgatgtggcatgttgagtag |
5728460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 210 - 247
Target Start/End: Original strand, 29424690 - 29424727
Alignment:
| Q |
210 |
taaaaactaaaaataagttaagggaccgaacaatgtat |
247 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
29424690 |
taaaaaccaaaaataagttaagggaccaaacaatgtat |
29424727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 208 - 236
Target Start/End: Complemental strand, 36756104 - 36756076
Alignment:
| Q |
208 |
attaaaaactaaaaataagttaagggacc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36756104 |
attaaaaactaaaaataagttaagggacc |
36756076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University