View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_high_43 (Length: 356)
Name: NF1863_high_43
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_high_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 13 - 341
Target Start/End: Original strand, 688797 - 689125
Alignment:
| Q |
13 |
aatattcaataatagaggttttgctataggaaactcccaacatcgcaagactttgtctccgtcgtaaccattaagactttgaaaccaccagaatctaaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
688797 |
aatattcaataatagaggttttgctataggaaactcccaacatcgcaagactttgtctccgtcgtaaccattgagactttgaaaccaccagaatctaaga |
688896 |
T |
|
| Q |
113 |
tatcctcttcctaccgaattcttcagaagaggtggtggatagagaggnnnnnnnnnnctgagattctccactaaatatgaatgcaaacaaaatttccttt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
688897 |
tatcctcttcctaccgaattcttcagaagaggtggtggatagagaggaaaaaaaaaactgagattctccactaaatatgaatgcaaacaaaatttccttt |
688996 |
T |
|
| Q |
213 |
ctaactttacattagaaatctctttgcacaaagacatgcagtgaggagcttttaagtgaacaacgaannnnnnnngcagaatcgatttatgatagatttg |
312 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
688997 |
ctaactttacatttgaaatctctttgcacaaagacatgcagtgaggagctttcaagtgaacaactaattttttttgcagaatcgatttatgatagatttg |
689096 |
T |
|
| Q |
313 |
gcttatattcggttccacatttggagtag |
341 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
689097 |
gcttatattcggttccacatttggagtag |
689125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University