View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1863_high_72 (Length: 268)

Name: NF1863_high_72
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1863_high_72
NF1863_high_72
[»] chr5 (1 HSPs)
chr5 (79-268)||(3952431-3952620)


Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 79 - 268
Target Start/End: Complemental strand, 3952620 - 3952431
Alignment:
79 gatgtacagaatttgtgagtggttagtaaatgatggagcaaagaaatgaaagtgatatgcttcaacattggagaaaaggatcatggcaatggcaagggtt 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
3952620 gatgtacagaatttgtgagtggttagtaaatgatggagcaaagaaatgaaagtgatatgtttcaacattggagaaaaggatcatggcaatggcaagggtt 3952521  T
179 agagttagaggatatgaaagaaaatgatgaactaaacaaattaatgttgtctttgccagaaattcctgagccaccaacacctcttgagcc 268  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3952520 agagttagaggatatgaaagaaaatgatgaactaaacaaattaatgttgtctttgccagaaattcctgagccaccaacacctcttgagcc 3952431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University