View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_high_79 (Length: 252)
Name: NF1863_high_79
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_high_79 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 13 - 196
Target Start/End: Original strand, 36645587 - 36645770
Alignment:
| Q |
13 |
aggaatcattcccaatcccccgatttatggcatgtttttagttccaacagagttaacaagtctattgtgtaatgggtttggacctgaagaaaccatcctc |
112 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36645587 |
aggaatcatccccaatcccccgatttatggcatgtttttagttccaacagagttaatgagtctattgtgtaatgggtttggacctgaagaaaccatcctc |
36645686 |
T |
|
| Q |
113 |
acccttccgatttatggtttgttttcatcctcaacggaaacactgtcgctattgtgtattgggtctggacttgaaggaaccttc |
196 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36645687 |
gcccttccgatttgtggtttgttttcatcctcaacggaaacactgtcgctattgtgtattgggtctggacttgtaggaaccttc |
36645770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 103 - 242
Target Start/End: Original strand, 36645851 - 36645991
Alignment:
| Q |
103 |
aaccatcctcacccttccgatttatggtttgttttcatcctcaacggaaacactgtcgctattgtgtattgggtctggacttgaaggaaccttccgcaat |
202 |
Q |
| |
|
|||| |||||| || |||||||| || ||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36645851 |
aaccttcctcaaccctccgatttgtgatttgttttcatcctcaatggagtcaatgtcgctattgtgtattgggtctggacttgaaggaaccttccgcaat |
36645950 |
T |
|
| Q |
203 |
tctccaatttctg-gttttccccatatttgattcttgatga |
242 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36645951 |
tctccaatttctgtcttttccccatatttgattcttgatga |
36645991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University