View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_high_80 (Length: 251)
Name: NF1863_high_80
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_high_80 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 4 - 251
Target Start/End: Complemental strand, 24543890 - 24543643
Alignment:
| Q |
4 |
ggaggagcagagatagtagttaggggcaaagcagataaacatgtctcgtggaatatatgactgcatggaagaatagcaacttcagataaaacagtactac |
103 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24543890 |
ggaggatcagtgatagtagttaggggcaaagcagataaacatgtctcgtggaatatatgactgcatggaagaatagcaacttcagataaaacagtactac |
24543791 |
T |
 |
| Q |
104 |
tcaaatcttctcttccttgggaagagaataaataatgttgtagctcatcttctccatcttgaattgaatcttcctctgcctctttatcttctaaatcttt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
24543790 |
tcaaatcttctcttccttgggaagagaataaataatgttgtagctcatcttctccatcttgaattgaatcttcctcttcctcttcctcttctaaatcttt |
24543691 |
T |
 |
| Q |
204 |
cccacacaacacacaagtataacatgtacttgtttcatcaatgcctgt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24543690 |
cccacacaacacacaagtataacatgtacttgtttcatcaatgcctgt |
24543643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University