View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_high_92 (Length: 242)
Name: NF1863_high_92
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_high_92 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 4 - 227
Target Start/End: Original strand, 36456084 - 36456307
Alignment:
| Q |
4 |
atgaaccttatttgcgagatggtaattcaaagtttccaacttttttgtatgctatgccatttagttccaatttgatttttcttgaagaaacttcgcttgt |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36456084 |
atgaaccttatttgagagatggtaattcaaagtttccaacttttttgtatgctatgccatttagttccaatttgatttttcttgaagaaacttcgcttgt |
36456183 |
T |
 |
| Q |
104 |
tagtcgtccggttttgtcttacatggatgtgaagagaagaatggttgcaaggttaaggcatttgggaattaatgtgaagagggtattggaagatgaaaag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36456184 |
tagtcgtccggttttgtcttacatggatgtgaagagaagaatggttgcaaggttaaggcatttgggaattaatgtgaagagggtattggaagatgaaaag |
36456283 |
T |
 |
| Q |
204 |
tgtttgattccaatgggaggacct |
227 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36456284 |
tgtttgattccaatgggaggacct |
36456307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 36462490 - 36462282
Alignment:
| Q |
19 |
gagatggtaattcaaagtttccaacttttttgtatgctatgccatttagttccaatttgatttttcttgaagaaacttcgcttgttagtcgtccggtttt |
118 |
Q |
| |
|
||||||||||| | |||| | | |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
36462490 |
gagatggtaatgccaagtcttctacttttatgtatgctatgccatttagttcaaatttgatttttcttgaagaaacttcgcttgttagccgtccggcctt |
36462391 |
T |
 |
| Q |
119 |
gtcttacatggatgtgaagagaagaatggttgcaaggttaaggcatttgggaattaatgtgaagagggtattggaagatgaaaagtgtttgattccaatg |
218 |
Q |
| |
|
|||| ||| ||| ||||| | ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||| | |||||||||||| |
|
|
| T |
36462390 |
gtctcacacggaggtgaaaacgagaatggttgcaaggttaaagcatttgggaattaatgtgaaaagggtattggaagatgagaagggcttgattccaatg |
36462291 |
T |
 |
| Q |
219 |
ggaggacct |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
36462290 |
ggaggacct |
36462282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University