View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_102 (Length: 237)
Name: NF1863_low_102
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_102 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 44046431 - 44046651
Alignment:
| Q |
1 |
aacttaggaggataaataactcaatttannnnnnn-cccttaggttccctcctggttcggagttaatcccatttgagtcgtgtaggacactaaatatgga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44046431 |
aacttaggaggataaataactcaatttattttttttcccttaggttccctcctggttcggagttaatcccatttgagtcgtgtaggacactaaatatgaa |
44046530 |
T |
|
| Q |
100 |
tacttctttcaactaaaattcaaactttaatttgtcattttgcgggagtctagcccttttcgctagatcaaactcccatttgtataactcaaaattctat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44046531 |
tacttctttcaactaaaattcaaactttaatttgtcactttgcgggagtctagcccttttcgctagatcaaactcccatttgtataactcaaaattctat |
44046630 |
T |
|
| Q |
200 |
caagttgaaaaatgtcacaat |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44046631 |
caagttgaaaaatgtcacaat |
44046651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 84 - 158
Target Start/End: Complemental strand, 10436496 - 10436422
Alignment:
| Q |
84 |
ggacactaaatatggatacttctttcaactaaaattcaaactttaatttgtcattttgcgggagtctagcccttt |
158 |
Q |
| |
|
||||| ||||||| ||||||||||||| | |||||| |||||||||| ||||| ||| |||||| |||| |||| |
|
|
| T |
10436496 |
ggacattaaatatagatacttctttcagccaaaatttgaactttaattcgtcatgttgtgggagtttagctcttt |
10436422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University