View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_105 (Length: 236)
Name: NF1863_low_105
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_105 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 169 - 228
Target Start/End: Original strand, 41345397 - 41345456
Alignment:
| Q |
169 |
ctgcataatatatttgaattgaagaaatgcggtatactaatcaatcttcaatgttgctga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41345397 |
ctgcataatatatttgaattgaagaaatgcggtatactaatcaatcttcaatgttgctga |
41345456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 54
Target Start/End: Original strand, 41345252 - 41345281
Alignment:
| Q |
25 |
taagttttgaaatttcaacgaccatgatga |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41345252 |
taagttttgaaatttcaacgaccatgatga |
41345281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University