View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_107 (Length: 235)
Name: NF1863_low_107
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_107 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 8262208 - 8262428
Alignment:
| Q |
1 |
ttataggagtgtcttcggtatagagtgggtagggaaggggttgaaaaatggatgaggagtgttgaaagttcataaggctgggaaataaataaacctactt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8262208 |
ttataggagtgtcatcggtatagagtgggtagggaaggggttgaaaaatggatgaggagtgttgaaagttcataaggctgataaataaataaacctactt |
8262307 |
T |
 |
| Q |
101 |
gaaaataatttgagttttgaattgctgattaatttgttcaacctggttctttgattaaataagttaaatttgagtttaaaattaagctcttcaaataaat |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8262308 |
gaaaataatttgagttttgaattggtgattaatttgttcaacctggttctttgatcaaatgagttaaatttgagtttaaaattaagctcttcaaataaat |
8262407 |
T |
 |
| Q |
201 |
aagttaatttgagtaatatat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8262408 |
aagttaatttgagtaatatat |
8262428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University