View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_111 (Length: 230)
Name: NF1863_low_111
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_111 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 36990576 - 36990405
Alignment:
| Q |
1 |
agatttgagattggttggtgttgcaagtttgatagtactccttcgttggctttgttgttctcttcagctaatgcgtcacagaatgctctgtgggtaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36990576 |
agatttgagattggttggtgttgcaagtttgatagtactccttcgttggctttgttgttctcttcagccaatgcgtcacagaatgctctgtgggtaatga |
36990477 |
T |
 |
| Q |
101 |
agctgtctcttctgcatatagtaaataaatcaattaataagaaactctcttagccaggtgaatatgtaagttaaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
36990476 |
agctgtctcttctgcatatagtaaataaatcaattaataagaaactctc-tagccaggtga--atgtaagttaaa |
36990405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 53 - 115
Target Start/End: Original strand, 44150142 - 44150204
Alignment:
| Q |
53 |
tgttgttctcttcagctaatgcgtcacagaatgctctgtgggtaatgaagctgtctcttctgc |
115 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||||||||||| || || |||||||| |||| |
|
|
| T |
44150142 |
tgttgttttcttcagttaatgcatcacagaatgctctgtgggttataaaactgtctctcctgc |
44150204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University