View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_113 (Length: 226)
Name: NF1863_low_113
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_113 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 8262031 - 8262113
Alignment:
| Q |
1 |
tagtgagaggaacttggtctaaaatttatgaa-ttaattatgttatataggtcagactagataaataattaactagtttcttt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |||||| |||||||||||||| |
|
|
| T |
8262031 |
tagtgagaggaacttggtctaaaatttatgaaattaattatgttatgtaggtcagactagacaaataaataactagtttcttt |
8262113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 226
Target Start/End: Original strand, 8262189 - 8262229
Alignment:
| Q |
186 |
gtccatgcttattagtccattataggagtgtcttcggtata |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8262189 |
gtccatgcttattagtccattataggagtgtcatcggtata |
8262229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University