View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_30 (Length: 421)
Name: NF1863_low_30
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_30 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 2e-53; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 278 - 421
Target Start/End: Original strand, 33269297 - 33269444
Alignment:
| Q |
278 |
atggttgatcaagcacagaaa----gttaatctctatctgcttgcattgcagtgatacctcacctggcgtagcacacgatgctttcaacaccttcttcag |
373 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33269297 |
atggttgattaagcacagaaatgttgttaatctatatctacttgcattgcagtgataccacacctggcgtagcacacgatgctttcaacaccttcttcag |
33269396 |
T |
 |
| Q |
374 |
tgagactggatcgggcaagcatgtaccaagggccttatttgttgatct |
421 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33269397 |
tgagaccggatctggcaagcatgtaccaagggccttatttgttgatct |
33269444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 19 - 124
Target Start/End: Original strand, 33269094 - 33269199
Alignment:
| Q |
19 |
cttcttagatcaattgagaattgccaaattggaaaaccaggaacatctcttcaatttggattaacatcttgcttatctatattctaattctatttctgaa |
118 |
Q |
| |
|
||||| ||| |||| ||||||||||||| |||||||| |||||||||||||| ||||||||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
33269094 |
cttctgagaccaatagagaattgccaaaatggaaaactaggaacatctcttcgatttggattcacttcttgcttatctatattctaattctatttttgaa |
33269193 |
T |
 |
| Q |
119 |
gcaagt |
124 |
Q |
| |
|
|||||| |
|
|
| T |
33269194 |
gcaagt |
33269199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 124 - 199
Target Start/End: Original strand, 33269223 - 33269298
Alignment:
| Q |
124 |
tggttgattagtgattaggcccaaataatactgatttctatgttgcttttcttgatgtttggattttttaactcat |
199 |
Q |
| |
|
|||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33269223 |
tggttgattaatgattaggcacaaataatgctgatttctatgttgcttttcttgatgtttggactttttaactcat |
33269298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 349 - 397
Target Start/End: Complemental strand, 40378426 - 40378378
Alignment:
| Q |
349 |
acgatgctttcaacaccttcttcagtgagactggatcgggcaagcatgt |
397 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| | || |||||||| |
|
|
| T |
40378426 |
acgatgctttcaacaccttcttcagtgaaactggagctggaaagcatgt |
40378378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University